Information

What happen if we inject restriction enzyme into the blood

What happen if we inject restriction enzyme into the blood


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Just a curious question, if we extract restriction enzyme and inject it to our body, what happen?

  • Does antibody recognize and block it?
  • Can restriction enzyme pass over cell membrane and destroy the DNA of a living cell ?

The appearance of any foreign antigens (e.g., proteins like restriction enzymes fall n this category) in the circulatory system should trigger an immune response.

There are actually two membrane barriers that the enzymes have to traverse to gain access to the nuclear genome: the cell membrane, and the nuclear membrane. Proteins are typically too large and too charged to cross a lipid bilayer membrane--unless there is a pore (like on the nuclear membrane) or receptor for the protein on the cell surface.

When cells are engineered to express foreign restriction enzymes using transgenes, then yes, if the protein can enter the nucleus then the enzyme will start to digest all of its recognition sites.

Jasper Rine demonstrated this for the Baker's Yeast S. cerevisiae in 1986.


Discovery of Restriction Enzymes

Download the video from iTunes U or the Internet Archive.

OK, so I'd like to go now to the next segment of the course.

Think you can probably appreciate little bit better this triangle I had on before about how what biochemists did was they tended to break cells open, look at the component parts, through other things in there, and then proteins.

But an awful lot of stuff having to do with function is proteins, and what geneticists, the discipline of genetics would do, which made mutants of living organisms, and that looked at how function was affected by mutating individual genes, how those were both very powerful approaches. Genetics told you what was really important, and biochemistry told you how it worked at a molecular level, but the real problem is knowing whether this thing you had doing something in the test tube was actually the one that did it in life.

And I think it'll do when Arthur Kornberg isolated the very first DNA polymerase, he was able to copy DNA. And he got a Nobel prize, and it was the first enzyme that could copy DNA, and then John Karens made a mutant that was lacking the enzyme. And the organism was still alive.

So therefore, it couldn't have been the DNA polymerase that was copying the chromosome. It actually turned out to be a DNA repair enzyme. So, if you can actually unite genetics and biochemistry, if you can take a mutant that's broken in a function and you found your protein was missing, or vice versa, then you had a very, very powerful insight because you connect your knowledge of what was physiologically important to the biochemistry that you're doing. But it was really, really hard for years, and only in very rare occasions did some geneticists have a mutant that suggests so strongly that some biochemists would look, or some biochemists would have such a powerful result that they talked to a geneticist and seen if anybody had found the result.

And the power of recombinant DNA, although it started a biotech industry, and it made possible the sequencing of the genome, there's another level up one higher in conceptual understanding.

And what it did was, it let you go back and forth between here and here.

You wouldn't have any problem now if I gave you the sequencing of the gene, you can order it. You could stick it in a cell and make massive amounts of the protein. You purified it twenty-fold and it would be pure, whereas before you might have had to purified it fifteen thousand-fold out of 1,000 g of cells, and you would have had to been a very good biochemists with 15 steps in order to purify it. So, you can go from the sequence of the gene to the protein, or if we got a protein and we wanted to know which gene we'd just sequence a bit of the protein, use that genetic code, work ourselves backwards to some possible sequences, then go looking for the sequences, and then go find the gene. So, what recombinant DNA allows us to do is close that loop. You can go from genetics to biochemistry at back and forth. Now everybody does everything instead of it being isolated disciplines, which it was when I entered the field. So, all of the stuff depended on the development to clone particular pieces of DNA.

And I want to make clear right at the beginning, there's a couple of uses of cloning that are in popular usage right now. What we're talking about in this lecture is cloning a piece of DNA. What that means, is I'm going to take a particular segment of DNA, say, cut it here, and cut it there.

And I'm going to take that piece, and I'm going to do something to it that lets me amplify it and make many, many copies of that piece of DNA. And cloning of anything else you make a whole lot of copies.

So that's one use of the word cloning.

The other use, which you see in the popular press all the time, is cloning an individual, but not being there but you would take the nucleus from the cell of the individual, he put that nucleus into an egg that didn't have its own nucleus moved, and now you hope what you get out of that is an organism that has all the same genetic content as the starting individual.

And in fact, although it sounds very good in paper, is you're probably beginning to see it's not the panacea that people thought it was, or that we'd have to worry that in 10 years, all of my MIT students would be clones of the brightest person in the class or anything like that, because other stuff happens, because unless you go on to advanced biology courses, but there are modifications of DNA. There's all sorts of stuff that happens to it, so it's not identical.

And so many of these cloned organisms, like Dolly the sheep, that was famous, died early with, I forget, arthritis and things. So, there are a lot of problems on that score. But that's the other use of the word cloning and that's not what these next three lectures that we are talking about cloning a piece of DNA. And that was the big problem that faced the field, certainly when I was an undergrad and even when I was a grad student I was interested in synthesizing pieces of DNA, and it was one of those things that people said, why are you doing it? Well, because you could try to do it. What if you got a piece of DNA, like Gobind Khorana, who's my colleague, who got the Nobel prize for synthesizing the first gene.

He synthesized it. It was a tRNA gene that was 120 nucleotide base pairs long or something. He synthesized it.

He'd shown you could do it. But you couldn't do anything with it.

And there were sort of two big problems. One was the fact that this DNA, although it's not its a monotonous tetranucleotide.

It's pretty hard to tell. Each one of these things is a base pair, and human DNA has 3 billion of those. And a bit down here, doesn't look very different than the bit out there.

And it certainly wouldn't looks very different than the bit of DNA that's 2 billion base pairs over on the other side of campus or something. So, there is no way to take DNA and cut it reproducibly, so you to get fragments.

What you could see from first principles was what you would need was magic scissors. And what would the scissors look like? Well, it would have to be scissors that could be sequenced because there's nothing else different. You know it's a regular backbone, and it's only four nucleotides. So, if you wanted to cut DNA in particular places, you had to have scissors that could see a sequence.

And furthermore, you can see they couldn't just, there are the hydrogen bonding parts of ANT or GNC because those are stuck together there in the middle of the DNA.

So, you'd need scissors that could somehow find a sequence and make a cut. And those were found. I'm going to till you about those.

They're called restriction enzymes. So that was part of the thing. The other thing was, imagine I could cut out this fragment. And they gave it to you, and I said, great. Now I've got it.

Would you make me a lot of copies of this DNA?

Could you do that? Let's say, you now know how to transform the principle that we saw back with Avery.

We could take naked DNA and put this fragment into the cell.

Would it replicate? What do you think? Anybody remember?

No? OK, we talked about some other languages, right?

But one of the things that's in the DNA is the genetic code with all the genes. And we can find the reading frame. Remember when we talked about an origin of replication. I said that was sort of, at least for E. coli there's one origin. In eukaryotes the origins are spaced out along the DNA. And every time you have a round of replication, it starts with one of those origins and then goes.

So the chance of this piece of DNA by chance is going to have an origin is pretty small. So if I put it into an organism, it's going to sit there, if you're lucky, make it degraded because it's got [blend ins? , or even if I made it into circle it probably wouldn't replicate because it probably doesn't have the word in the DNA that says start a round of DNA replication.

So, the other overarching principle of DNA replication is you somehow have to take the fragment of DNA that you're looking at, and you have to attach it to an origin of replication.

Now, if you have an origin of replication and you have a fragment of DNA, and you put it in the cell, now you'll get a lot of copies of that piece of DNA. So that's what recombinant DNA is all about in a really, really simple form. I'm just going to take you now into increasing sort of levels of detail.

So, let me just sort of give you just sort of a really broad view of this cloning, and then we'll sort of start to dive in to some of the fancier techniques that have come out of this.

We'll talk about DNA sequencing, and PCR, and stuff in the next lecture. So the first principle here is to cut the DNA, and I know you may think this is sort of baby talk, but this is how I think. If you really think about this stuff, this is what it really is. With sequence specific molecular scissors, these have the rather odd name.

They're called restriction enzymes. I don't know if any of you know why they're called restriction enzymes, and although I'm sure that some of you have used them in your op to cut up pieces of DNA.

But what that does, these are enzymes, as I'll tell you, that recognize a particular sequence. And they always cut at that sequence. In the value of that is you can reproducibly cut DNA exactly the same spot, and the spots are specified by whatever sequence that particular pair of scissors knows how to read.

Then the next thing we have to do is we need to join the piece of DNA to an origin of replication. So the thing that carries the origin of replication is called a vector. And usually, not always, these are circles. We'll consider the ones that grow in E. coli are most of the time, or in bacteria, mostly circles.

They are the ones that are broadly used for most cloning.

So, we'll talk about those. What makes a vector? When it has to have is an origin of DNA replication. They usually have something else. We could call it a selectable marker, but something like a drug resistance.

If any of you have done cloning in a UROP usually it's something like a gene for making the cell ampicillin resistant, or tetracycline resistant, some antibiotic that would normally kill the cell.

So you can tell, does that cell have that vector or not because the cell starts at either ampicillin sensitive.

It acquires the vector that's replicating it, also acquires the gene that gives it the drug resistance.

But if we're going to cut that, if we're going to join a piece of DNA to that, we can't join into a circle without breaking it.

So, we need to cut the vector at a unique site. And we would use a restriction enzyme for that. And you can also see in designing a vector, you'd want something that only has one site.

So, what we would have achieved from this conceptually as we've now got this, this is the vector, its origin of replication here, and let's say ampicillin resistance, for example, as a selectable marker, the gene for that could be encoded here. And we have the fragment of, if you want to that down, just put it down on the floor, I think. We've made the point at this stage. Thanks.

What one has to do is to join this piece of DNA to that.

And we'll go to the molecular details of this.

But, we'll join the fragment to the vector, and actually this was something that was already in molecular biologists' toolkits, have been studying DNA replication. That's DNA ligase.

When we finish an Okazaki fragment, we had to seal [UNINTELLIGIBLE] and the enzyme that did that was an enzyme called DNA ligase.

So, molecular biologists basically had the scotch tape or the glue to join stuff back together. What they were missing for many, many years where the sequence specific molecular scissors.

So at this stage, if we were doing the recombinant DNA, we now have a vector. We now have a piece of DNA joined to it. In fact, we probably have a whole other mess of things that happens along the way.

But at the moment, they're in a test tube.

So, if we want to have this thing grow, what do we have to do next?

We are going to have to get the DNA from outside the cell inside the cell. That's the word we need to transform the DNA into a cell.

Again, the word transform, that goes back to those transformation experiments with the Streptococcus pneumonia going from smooth to rough, and you are taking stuff from the cell that transformed them from rough to smooth, whatever, that's where the word came from, but we now know it's getting naked DNA inside the cell where it can be replicated.

And then the next thing we need to know is, what cells have acquired this vector that at least as the vector.

We'll settle for that in the beginning, and to do that, you need to select for the marker on the vector. In the case of this one, we would start with a strain that killed my ampicillin, and then we just play it out and ask for guys that are ampicillin resistant. And, you can see that there is another class of problem because if we had uncut vector, and there would probably be, for sure, some of that in our mix, that would make the cells ampicillin. And if we had an insert, it would also be ampicillin. So, if we really wanted to get into this, we'd have to do some more work to sort out what's on there.

But that's the basic stuff. I suspect most of you know this practically since kindergarten. But that's the overall framework into which, now, I'm going to start layering different pieces of detail. And the next part, again, some of you may know. I don't think it will be a totally foreign concept. You are probably familiar with this, that what are these restriction enzymes? The actual word is restriction endonuclease. They are often usually called restriction enzymes in a lab [parlons?]. Nuclease is something that cuts the nucleic acid, and endonuclease is one that doesn't need a free end. So, it can cut in the middle of the sequence instead of nibbling at the end. That would be an exonuclease. So, these things have names that tend to be something like ECO-R1, which has something to do with where they are derived from. And a typical one, one of the very first ones that is still in really wide use, is ECO-R1.

And this recognizes the sequence G A A T T C.

Now, you'll notice that if you read the sequence in this way it's the same sequence when you read it on the other strand.

It's called a palindrome but be careful because palindromes in English, those are words that you read from the front to the back they're the same. In an English letter, it doesn't matter whether it's in A here or an A there.

But you guys know something about DNA structure.

There's a five to three prime polarity. So, reading this way doesn't look at all the same. It's totally different.

But reading in this strand, we say that's five to three.

The thing that's identical is the reciprocal sequence on the other side. So there is this, you see G A A and G A A but it's not like the English word palindrome, so get yourself mixed up about that.

Anyway, what this will then, what this enzyme then does, is it cuts to the side here. It cuts symmetrically.

And what it generates them is a G three prime hydroxyl.

Remember the ribose? If we have, say, an A there, this is the three prime position, and that's the five prime position in the sugar. So, it leaves a three prime hydroxyl, and is also then leaves a five prime phosphate.

So, we'd have A A T T C here, and then on the other side, we would get the reciprocal thing. So, we'd have G with a three prime hydroxyl, and then over A A T T C like that.

So now we've got a break here. We can pull those apart. But one of the nice things you can see right from this is that we're generating five prime single stranded ends, and this one is the sequence A A T T C. This is A A T T C here, and these guys, if they could get together and line up as they would here, they'd be able to form hydrogen bonds. So, if you take an enzyme like ECO-R1, and we took, let's say, a circle that had a single ECO-R1 site, G A A T T C, if we cut it with the restriction enzyme we would make [nicks?]. And if we kept a cold, all that we'd have is DNA nicks. And if we warm things up a little bit, there's only four hydrogen bonds that are holding that together.

So, the thing would linearize and just flop around in the breeze.

If we cooled it slowly, the thermodynamically most favorable state, the lowest energy state, would be with those ends coming back together. So, we could then add DNA ligase.

If we added these up and added DNA ligase, we could reverse the process and go back and forth, ECO-R1 to cut it, DNA to ligate it.

And then, the beauty of recombinant DNA is this rejoining part doesn't see what's out here or what's out there.

All it sees is the little ends that are generated by an ECO-R1 site.

So they take some of my DNA, and I'll cut it up.

I'll get a zillion ECO-R1 fragments, but they'll all have the same little overhanging bit that's complementary to the vector.

So if I take a vector cut with ECO-R1, and I take some of my own DNA and I mix them, I can get a little fragment, get in between the vector, and it does exactly that joining that I was diagramming right here. So again, it was the discovery of these restriction enzymes that made possible almost all the stuff that's happened in biology since 1975. The development of restriction enzymes was essentially, I was a postdoc at Berkeley at that point and the labs, Stan Cohen at Stanford, Herb Boyer at UCSF, and a two others around the country were working on this. They were almost all labs that had worked on bacterial plasmids. Plasmids are little circles of DNA, so the labs that started were ones who have been busy studying little circles of DNA that usually carry drug-resistances between cells.

And so that was happening while I was a postdoc.

And when I got to MIT and '76 the technology was just beginning.

I was one of the first labs trying to cut pieces of DNA and join them back together. So, it's a pretty recent development.

At that point, DNA sequencing hadn't been invented.

The idea that you could pull out a piece of DNA and do something with it or produce a protein was just a thought. It didn't exist.

So it's hard to overemphasize how critical the discovery of these restriction enzymes were. Now, I just want to tell you where they came from, or how people found them.

And they'll try and do this quickly because I know some of you get impatient with history. But this is really important because it's very easy to make fun of basic research. You can ridicule anything pretty easily, and you might just ask because I'm telling you the story. Somebody proposed doing this.

I'm going to tell you the experiment that basically is the basis of the biotech industry, and would you have been smart enough to recognize that it was the discovery of a phenomenon called restriction, restriction in bacteriophage growth on bacteria?

And it was, here are actually a couple of EM's and these little plasmids. This is an electron micrograph one.

In these little circles it's been shadowed. And this is actually artificially colored, but that was the kind of plasmids that people were cutting up. So, as I said, trying to get through this DNA, and the stuff, what's made possible the sequencing at the Whitehead Genome Center and stuff that I'll tell you about is going on. I didn't really set this one up.

But that's Eric Lander who teaches 701 in the fall.

I told you a picture from that DNA 50th. Well, they had a banquet at the end of it, and I was there.

This is [Savandi Pabo? from Europe who is sequencing the chimp genome. And that's Francis Collins who is head of the entire Human Genome Project. This is Evelyn Witkin, who was a big discoverer of early DNA repair events.

And I put that one in because it was sort of interesting.

There was Eric, and Savandi, and Francis were talking about what would happen when they knew the sequence of the chimp genome, which wasn't done. And there was an advertisement, a poster advertising Jim Watson's latest book. And they ripped that in half, and were writing notes on the back all the way through dinner.

So if you want to see what scientists on the cutting edge, including someone who teaches 701 the fall looks like when they are not teaching 701, there is a picture.

So anyway, the discovery of restriction enzymes was Salvador Luria, who I've mentioned. He was a member of the biology department, and one of our Nobel Prize winners.

He started the cancer center. He also trained at Jim Watson, when I showed you that picture. This is Salvador standing over here.

Another thing that Salvador did, he was a Nobel Prize winner but he thought introductory biology. So I am basically following in the footsteps of Salvador. He wrote a book called, even though he was a Nobel Prize winner, a book called 36 lectures in introductory biology. And some universities, the intro to biology is taught by whoever is at the bottom of the food chain. The most junior professor gets stuck with intro to biology.

And here it's the other way. I mean you're getting Eric and Bob, for example, Weinberg to teach in the fall, tells you that.

And really where that comes from is the fact that Salvador Luria had such an interest in replication. So he trained at Jim Watson, started the cancer center here, and he also carried out this phenomenon of restriction. And to get this working with bacteriophage. And I know a [couple he wrote?

, he didn't like to see old guys on porches. So I got freaked out, and I took this next picture out for this morning. Oh, I've got to show it anyway for two reasons. This is Salvador sitting on a porch at Cold Spring Harbor with Max Delbrook who started, really, much of the work on bacteriophage that gave us the underpinnings of microbiology. And then put it partly on A because it shows the informality of the molecular biology culture which persists to this day, and also because Salvador had such an impish sense of humor. You would have really enjoyed had he been teaching this course. Anyway, Salvador was studying this bacteriophage. Remember we talked about it?

And they basically [with syringe? they injected their DNA into the cell. There's an electron micrograph. The DNA is up top there.

It goes in, and then the DNA takes over the cell, reprograms it, and makes babyphage. And I showed you how we make plaques.

So that was what Salvador was studying. And it's a little like what we are talking about with Mendel. He didn't have very many techniques available to him at the time. He couldn't sequence DNA.

He couldn't do a lot of things. But he could [plate phage?

and count, and things like that. And what Salvador was looking at, he had a bacteriophage, and he had two strains of bacteria.

I'll call them A and B. OK, here comes the experiment that founded the biotech industry. You ready? You going to fund me?

All right, so what I propose doing is I'm going to grow the phage on strain A, and now I'm going to plate on strain A and strain B.

I laid awake all last week thinking of this experiment.

So what did I get? I got a lot of plaques on strain A, probably something like 109 or 1010 per mil because that's what this phage lysate usually looks like once you've grown them up.

And if I plate them over on strain B, no phage, maybe an occasional phage. So, I bristly the bacteriophage can grow mine on strain A. It can't grow on strain B most of the time, but some variant has managed to figure out how to grow on strain B. Give our foray into genetics, I think many of you would think, probably as I suspect Salvador did at the time, the things mutated. It's learned. It's made some change in its genomes that's allowed it to grow on strain B. So, I wonder if it learned to grow on strain B, couldn't grow on strain A? So, basically what he took was the phage from that experiment, and then he plated them on strain A and strain B. And, well, as you might guess, since it was growing on strain B, lots of plaques, and there were lots of plaques over here. OK, so it didn't forget how to grow on strain A. So, better check over here, too, need a control experiment, so take this guy, plate it out, strain A, strain B, some plaques over here.

That's not a surprise going in strain A.

We are back to where we started from. It doesn't sound like a mutant, does it? And if it was a mutant, everybody should have been the same.

Instead, when you grew a phage on strain A, it didn't have the ability to grow on strain B. But if you gave it a chance to grow on strain B, most of them wouldn't make it.

But if it ever did, it had now acquired the ability to grow on strain B. So it could still grow on both.

But if you take somebody who had been growing, something had been growing at strain A, it lost it. And so, the idea there was then that it wasn't a mutation. Something was happening in the strain B that enabled it to grow on strain B.

And if it ever got away from that environment, [it?

lost it. So, the phenomenon was called restriction.

It wasn't a mutation. It was something else.

And it turned out, then, that restriction was due to an enzyme. An example of this kind of thing, then, would be this ECO-R1 activity that's able to cut at a very specific sequence. Now, if you are going to have a set of molecular scissors inside of you that could cut a G A T C sequences, you'd have a problem unless you did something else because every one of your G A T C sequences would be cut by the restriction enzymes.

So what the cells that have a restriction enzyme have, as a modification enzyme that recognizes the same sequence, and then modifies it in some way that makes it resistant to the restriction enzyme. And in the case of the ECO-R1, it puts on a methyl group on this A. You might have thought that that would interfere with base pairing, but it doesn't because adenine looks like this. These are the guys that do the base pair refining, if you look back, and you'll see that you could put a methyl group in there. It wouldn't interfere with the base pairing, but would allow this to go. So, it was the discovery of this phenomenon of restriction of bacteriophage grew on one strain, not on another. It could learn to grow on the other strain.

It could lose that acquisition. It was that phenomenon. People, didn't have any other reason other than it was an interesting problem in biology to understand it. Once they understood the basis of it, another whole world opened up because you could see from basic principles, now I could cut any piece of DNA. I could generate these little overhanging sticky ends. I could take a plasmid.

People knew about those. I could find one that only has one restriction site. I could stick things in.

Now I've attached an origin of replication to each of those pieces.

And I'm in business. I can now, for the first time ever, take a particular piece of DNA and make as many copies as I want.

And that was an absolute transformation to the way people were able to think about biology. So I'm going to just kind of give you an idea of how people would start. So the way people began and still began most things is they'd call it, the usual term is you call constructing a recombinant DNA library.

And there are a variety of different ways of doing this.

But this principle is the same. We'd take the DNA from whatever organism you're interested in, [and studying?].

And we cut with some restriction enzyme. And this restriction enzyme will cut wherever there happened to be sites. They might be close together. They might be far apart. But whatever, still generate some characteristic set of fragments. And we'll now have, in this case, fragment number one, fragment number two, fragment number three, fragment number four, and so on. And if it's my DNA, there's a lot of fragments. And of course, they're all mixed up.

I can't tell where any of them are. They're just all mixed together in the test tube. Then we'll take that vector that we've opened. And now, we'll mix all of these fragments together with this vector. And then we join it just the way [that it's cut? . And now what we'll get, it's a collection of plasmids that have different inserts.

So, one of the plasmids will have that fragment number one.

Another one of them will have fragment number two, number three, and so on. Then this whole thing is what's known as a library. You can see if it's DNA from me, there were 3 billion base pairs to start. Given the human DNA, G A T C sequences are pretty common. You can calculate the frequency yourself for how many sites on average there would be for a restriction enzyme within a piece of DNA and figure out roughly how the fragments there would be in the library of human DNA.

So, we are partway there. We can now make a library.

We can make it from bacterial DNA. We can make it from human DNA. But the next thing that people had to learn how to do was to figure out how to find a particular fragment that had the gene that you are interested in. And there's a whole variety of things. I mean, ultimately today since the human genome is sequenced, you go on a computer and a type and you find it because the sequence is all known. But the only reason we can do that is because of all the work that was done in between.

So, I'll give you several ways of doing this. But one of the ways I think you can see very easily, and it's actually going back to the term complementation. Remember complementation?

We had something that was mutant, and then we'd put in a wild type gene, and fixed it up again. So, for example, suppose I was studying histidine biosynthesis in E.

coli, and I wanted to find the gene that encoded the enzyme that I had just disabled in my histidine minus mutant. So, if I have a [hisoxotroph?], I'll call it a [his G?

gene, for example, that's one of the genes involved in making histidine. So, since it's a histidine auxotroph, if I have it on just minimal glucose plates, and I streak it out, it's not going to grow. But if I grow it on minimal glucose plus histidine, then it will be able to grow, right? So, I've got a variant of this organism.

It's got a single mutation in it that's affecting one gene.

And because I don't have that gene, I can't grow on minimal.

If I made a library of E. coli DNA, which is going to have a lot of fragments as well, and I took that library and I put it into this mutant, I'm going to get a big mess of things, all the different plasmids with all the different fragments that go into that mutant. How am I going to find the one that I want? Anybody see that? It's not that hard. I'm the mutant.

I can't grow on minimal because I can't make this enzyme.

Therefore, I can't make histidine. What do I need? How could you fix me up if you were a doctor? What's the gene we want out of here?

The one that makes that particular enzyme that makes histidine.

Yeah, take the whole library, stick it in this mutant. If the gene coming in encodes DNA polymerase, I'm not going to help this guy. It still won't grow in minimal, take a gene involved in making part of the cell wall would help.

But if I put in the, I get a fragment of DNA that includes the his G plus gene, and I put it in here, it's going to grow up. If it has the plasmid that has, or let's say the vector that has the his G plus gene.

So what you've done is a really, sort of, you've used that principle of complementation that some of you were sort of wondering about when we were doing genetics. So, you'd break a copy of a gene.

In the things we talked about, we bring in a whole chromosome that included in it just a wild type copy of the gene. With recombinant DNA, we can really narrow it down in the extreme. We can bring in a piece of DNA that is only the gene that's broken.

And we can take the gene back to the wild type. One thing, just to close, you'll see, if you remember back when I talked about language that are not universal, although the genetic code is universal, promoters and things are not. So I couldn't ever do this with a human DNA, could I, because it wouldn't get expressed. So, we need some other ways of finding those. We'll talk about those on the next lecture, OK?


Recombinant DNA: Grade 9 Understanding for IGCSE Biology 5.12 5.13 5.14

In the last post on this topic, I explained about the two types of enzymes needed for the genetic modification of organisms:

Restriction enzymes that can cut up DNA molecules at specific target sequences, often resulting in fragments with sticky ends

DNA ligase that joins together fragments to form a single DNA molecule

The EdExcel iGCSE syllabus uses the example of the genetic modification of bacteria to produce human insulin. Human insulin is a hormone that helps regulate the concentration of glucose in the blood. It is made in the pancreas when the blood glucose concentration gets too high and causes liver cells to take up glucose from the blood and convert it to the storage molecule glycogen. Patients with type I diabetes cannot make their own insulin and so need to inject it several times a day after meals to ensure they maintain a constant healthy concentration of glucose in their blood.

Bacteria can be genetically modified so that they produce human insulin. These transgenic bacteria can be cultured in a fermenter and the insulin produced can be extracted, purified and sold.

How do you get hold of the human insulin gene?

Well the honest answer is that there are a variety of ways of achieving this. It can now be synthesised artificially as we know the exact base sequence of the gene but it can also be cut out of a human DNA library using a restriction enzyme. There are other ways too but for the sake of brevity (and sanity) I am not going to go into them here. [If you are really interested in this, find out how reverse transcription of messenger RNA from cells in the pancreas can allow you to build the insulin gene.]

How do you get the human insulin gene into a bacterium?

Remember that bacterial cells are fundamentally different to animal and plant cells. One difference is that bacterial cells have no nucleus and their DNA is in the form of a ring that floats in the cytoplasm. Many bacteria also have plasmids which are small additional rings of DNA and these provide a way for getting a new gene into a bacterium.

Bacteria exchange plasmids in a process called conjugation and so it is fairly easy to get the plasmid out of the bacterium. If the plasmid is cut open using the same restriction enzyme as was used to cut out the human insulin gene, the sticky ends will match up and so DNA ligase will join the two pieces of DNA together to make a recombinant plasmid. The diagram below shows the process for human growth hormone but it would be exactly the same for the example we are looking at.

If the recombinant plasmids are inserted into bacteria, the bacteria will read the human insulin gene and so produce the protein insulin.

How do you grow the transgenic bacteria on an industrial scale?

The bacteria that have taken up the recombinant plasmid are grown in a fermenter. This is a large stainless steel vat (easy to clean and sterilise) that often has several design features conserved between different varieties:

The fermenter usually has a cooling jacket to carry away excess heat. The jacket often has a cold water input pipe and the warmer water is carried away. There has to be some mechanism for mixing the contents of the fermenter so the diagram above shows paddles attached to a motor. Fermenters also need a sterile input system for getting air, water and nutrients into the fermenter but without introducing foreign bacteria and fungi. Air is needed as the bacteria are aerobic and need oxygen for respiration.

If the bacteria in the fermenter contain the human insulin gene, then they will be able to produce human insulin. This can be extracted, purified and sold to the NHS for treating type I diabetics.


DNA Restriction

The discovery of enzymes that could cut and paste DNA made genetic engineering possible. Restriction enzymes, found naturally in bacteria, can be used to cut DNA fragments at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary ends.

This animation is also available as VIDEO .

The discovery of enzymes that could cut and paste DNA made genetic engineering possible. Restriction enzymes, found naturally in bacteria, can be used to cut DNA fragments at specific sequences, while another enzyme, DNA ligase, can attach or rejoin DNA fragments with complementary ends.

dna ligase,dna fragments,restriction enzymes,genetic engineering,bacteria,sequences,discovery


What happen if we inject restriction enzyme into the blood - Biology

Are you sure?

This action cannot be undone. This will permanently delete All Practiced Questions.

Are you sure?

This action cannot be undone. This will permanently delete All Practiced Questions.

Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

Add Note
Add Note
Add Note

(1) B is the child of A and C.

(2) C is the child of A and B.

(3) D is the child of B and C.

(4) A is the child of B and C.

Add Note
Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

Heat killed S form Streptococcus extract treated with proteases is mixed with live R form Streptococcus cells and injected into living mice. What is most likely to happen?
1. The mice would live.
2. The mice would die.
3. The mice blood would have dead R cells
4. A new strain of Streptococcus will be present in mice.

Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

Addition of deoxyribonucleotides by DNA polymerase during DNA synthesis is an endergonic process. The source of energy used is:
1. ATP.
2. Energy from photons of light.
3. Entropy created from protein digestion.
4. The nucleotides themselves

Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

It is believed that all organisms have arisen from a single distant ancestor. The strongest evidence for this would be:
1. DNA stores genetic information in all organisms.
2. The genetic code is universally a triplet code.
3. The amino acids specified by particular triplets are almost always identical between any two organisms.
4. The genetic code is degenerate but unambiguous.


Recombinant DNA: Grade 9 Understanding for IGCSE Biology 5.12 5.13 5.14

In the last post on this topic, I explained about the two types of enzymes needed for the genetic modification of organisms:

Restriction enzymes that can cut up DNA molecules at specific target sequences, often resulting in fragments with sticky ends

DNA ligase that joins together fragments to form a single DNA molecule

The EdExcel iGCSE syllabus uses the example of the genetic modification of bacteria to produce human insulin. Human insulin is a hormone that helps regulate the concentration of glucose in the blood. It is made in the pancreas when the blood glucose concentration gets too high and causes liver cells to take up glucose from the blood and convert it to the storage molecule glycogen. Patients with type I diabetes cannot make their own insulin and so need to inject it several times a day after meals to ensure they maintain a constant healthy concentration of glucose in their blood.

Bacteria can be genetically modified so that they produce human insulin. These transgenic bacteria can be cultured in a fermenter and the insulin produced can be extracted, purified and sold.

How do you get hold of the human insulin gene?

Well the honest answer is that there are a variety of ways of achieving this. It can now be synthesised artificially as we know the exact base sequence of the gene but it can also be cut out of a human DNA library using a restriction enzyme. There are other ways too but for the sake of brevity (and sanity) I am not going to go into them here. [If you are really interested in this, find out how reverse transcription of messenger RNA from cells in the pancreas can allow you to build the insulin gene.]

How do you get the human insulin gene into a bacterium?

Remember that bacterial cells are fundamentally different to animal and plant cells. One difference is that bacterial cells have no nucleus and their DNA is in the form of a ring that floats in the cytoplasm. Many bacteria also have plasmids which are small additional rings of DNA and these provide a way for getting a new gene into a bacterium.

Bacteria exchange plasmids in a process called conjugation and so it is fairly easy to get the plasmid out of the bacterium. If the plasmid is cut open using the same restriction enzyme as was used to cut out the human insulin gene, the sticky ends will match up and so DNA ligase will join the two pieces of DNA together to make a recombinant plasmid. The diagram below shows the process for human growth hormone but it would be exactly the same for the example we are looking at.

If the recombinant plasmids are inserted into bacteria, the bacteria will read the human insulin gene and so produce the protein insulin.

How do you grow the transgenic bacteria on an industrial scale?

The bacteria that have taken up the recombinant plasmid are grown in a fermenter. This is a large stainless steel vat (easy to clean and sterilise) that often has several design features conserved between different varieties:

The fermenter usually has a cooling jacket to carry away excess heat. The jacket often has a cold water input pipe and the warmer water is carried away. There has to be some mechanism for mixing the contents of the fermenter so the diagram above shows paddles attached to a motor. Fermenters also need a sterile input system for getting air, water and nutrients into the fermenter but without introducing foreign bacteria and fungi. Air is needed as the bacteria are aerobic and need oxygen for respiration.

If the bacteria in the fermenter contain the human insulin gene, then they will be able to produce human insulin. This can be extracted, purified and sold to the NHS for treating type I diabetics.


Supplementary Information

This file contains Supplementary Figures 1-11, Supplementary Table 1 and legends for Supplementary Movies 1-3. (PDF 1937 kb)

Supplementary Movie 1

This movie shows red blood cell movement through the blood vessels in wild type embryos. (MOV 707 kb)

Supplementary Movie 2

This movie shows red blood cell movement through the blood vessels in cdh5 MO-injected embryos. (MOV 1831 kb)

Supplementary Movie 3

This movie shows red blood cell movement through the blood vessels in cdh5 GoldyTALEN-injected embryos. (MOV 89 kb)


What happen if we inject restriction enzyme into the blood - Biology

Are you sure?

This action cannot be undone. This will permanently delete All Practiced Questions.

Are you sure?

This action cannot be undone. This will permanently delete All Practiced Questions.

Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

Add Note
Add Note
Add Note

(1) B is the child of A and C.

(2) C is the child of A and B.

(3) D is the child of B and C.

(4) A is the child of B and C.

Add Note
Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

Heat killed S form Streptococcus extract treated with proteases is mixed with live R form Streptococcus cells and injected into living mice. What is most likely to happen?
1. The mice would live.
2. The mice would die.
3. The mice blood would have dead R cells
4. A new strain of Streptococcus will be present in mice.

Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

Addition of deoxyribonucleotides by DNA polymerase during DNA synthesis is an endergonic process. The source of energy used is:
1. ATP.
2. Energy from photons of light.
3. Entropy created from protein digestion.
4. The nucleotides themselves

Add Note

To unlock all the explanations of 38 chapters you need to be enrolled in MasterClass Course.

I WOULD LIKE TO KNOW MORE

It is believed that all organisms have arisen from a single distant ancestor. The strongest evidence for this would be:
1. DNA stores genetic information in all organisms.
2. The genetic code is universally a triplet code.
3. The amino acids specified by particular triplets are almost always identical between any two organisms.
4. The genetic code is degenerate but unambiguous.


MICROBIOLOGY 101 INTERNET TEXT

What the BASIC TOOLS of GE how are and how they work.

How GENE CLONING is carried out.

How DNA can be used to IDENTIFY all living organisms

How we can DETECT very TINY QUANTITIES of DNA even when they may be millions of years old.

In addition, ETHICAL problems of the GE revolution will be presented and some possible ways of dealing with them considered.

DESCRIPTION OF MOLECULAR BIOLOGY

I have listed some of the changes you may experience within your lifetime, indeed some within the next few years. With the sequencing of the ENTIRE HUMAN GENOME anticipated around the turn of the century, a whole new set of possibilities will be unlocked. Currently (Fall 1996) we have sequenced >10,000 of the

100,000 human genes, and the rate of sequencing is accelerating as sequencing techniques are improved. About 3,000 human genetic diseases are currently known. This means that approximately 14% of newborns are afflicted with a "visible" genetic disease. This does not begin to include the genetic-based " tendencies " (to develop cancer, arthritis, TB, colds, asthma, flu etc.) and/or " conditions " which all of us have what genetic conditions do you have? For example, I and my half brother suffer from a genetic condition called Celiac Sprue , which means that wheat protein ( gluten ) does bad things to the cells in our intestine and we can't eat pizza etc. However, we are FINE as long as we don't eat wheat products . Sprue is a common genetic "condition" that effects up to 25% of the Irish and lessor numbers of other ethnic groups. How many reading this are Irish? Some of you suffer allergies, nearsightedness, migraines, etc., all of which have their basis in your genome. Once the human genome is mapped we can not only identify the particular alleles each of us have, but we will eventually figure a way to replace " undesirable genes " with " good genes ".

CRITICAL THINKING QUESTION: How do we as individuals and a society define " good and bad " genes? For example, if it turns out that genes are at the basis of alcoholism or homosexuality or child molestation or manic depression , do we set out to "cure" people of these genes? If a " homosexual " gene is found, what would you do if you found a fetus of yours was carrying that gene?

One current problem with the genetic revolution is that knowing which gene causes a disease condition and being able to identify the presence of that gene in a person, doesn't mean we UNDERSTAND the molecular biology of the disease process, thus we usually CAN'T PREVENT or CURE the disease caused by a defective gene. An example of this TERRIBLE DILEMMA is that a number of genes that predispose women to breast cancer have been discovered (and new ones are continually being found). This raises important ethical and personal considerations.

If a CURE or PREVENTION is not possible, should a woman be told she carries such a gene?

If a cure or prevention is NOT POSSIBLE, would you want to know you had a time-bomb ticking in you?

  • Let's examine one more "gray-zone" situation before we proceed. Manic depression (MD) is an illness that strikes many people. In some it is relatively mild while in others it takes a terrible toll, often leading to SUICIDE. It is also appears to have a genetic basis as it runs in families, and often stigmatizes affected and unaffected members alike. I would wager money that most of you reading this know someone who is a manic depressive and, of course some of you are MD. Yet, the disease is often treatable by inexpensive drugs and psychotherapy, although many people suffer torment for years before they are properly diagnosed and treated. An interesting side of MD is that many of the creative artists and politicians have been (maybe some of our current politicians are MD) MD. Robert Schumann, Lord Byron, Vincent van Gogh, Winston Churchill and Alfred, Lord Tennyson all suffered the classical symptoms of MD (see " Manic-depressive illness and creativity ", Sci. Am. Feb. 1995 & Nov. 1995). Once we identify the genes causing MD, we can use this information to make decisions about whether to have MD gene-positive children or to ABORT any fetus carrying this gene. What would you do? Eventually we will be able to completely cure (repress) the condition. Will the ramification of these findings make for a less interesting and stimulating world? What is your opinion?

Should one's mate, boss, insurance Co., potential employer etc. have access to your genetic information? Can you think of situations where it would be logical and reasonable for others to have this information? How about the army? The CIA?

If you owned a life insurance Co. would you give your political donations to a congressperson who favored requiring potential policy holders to give this information to their insurance Co.

Who pays for the screening for disease-genes, the cost of which currently is high? Should I have to pay for your screening & vice versa ?

What if you control the genetic information and you know that giving it out will lead to an abortion what would you do?

What if you have access to the genetic information of someone your daughter/son, sister/brother etc. is going to marry and you don't think they've told them of a serious genetic "condition". Would you tell ? Who owns your loyalty? What is ethical here ?

A final reminder of anyone who is considering avoiding these problems gene therapy trials are currently underway (but they're having problems working: TIME 10/9/95 Science 269:1050 [1995]), people are deciding to abort on the basic of the results of fetal genetic testing and the number of identified defective genes increases almost daily (and some of the ones they find will be ones you and I carry).

HISTORY OF GENETIC ENGINEERING

In the 1950s it had been noted that if one grew a particular bacteriophage on a particular bacterial mutant host strain ( A ) and then infected a bacterial mutant-strain ( B ), of the same species, with the phage A , the yield of phage from strain B was VERY LOW. However, if you took the few phage B that were produced and infected strain B with them, the phage yield was now NORMAL . Subsequently, in the 1960s, it was found that the phage DNA that grew on strain B had been CHEMICALLY MODIFIED so that it could not be cleaved (destroyed) by a DNase in strain B . The DNase involved in this cleavage was found to be somewhat specific, in that it mainly cut the DNA at CERTAIN SEQUENCES unless these sequences had been CHEMICALLY MODIFIED by enzymes in the cell (missing in strain A ). All previous DNases cut DNA randomly, so this finding suggested that DNA could be cut up into SPECIFIC FRAGMENTS which would ALWAYS contain the SAME SET OF GENES between the cut-sites. However, these first "specific" DNases did not prove as SPECIFIC as hoped. Finally, in 1970 Hamilton Smith accidentally found that a DNase from the bacterium, Haemophilus influenzae, CUT DNA ONLY at UNIQUE DNA SEQUENCES known as PALINDROMIC SITES .

PALINDROMES

In DNA a PALINDROMIC SITE is a SEQUENCE OF BASE PAIRS in double stranded DNA that reads the same backwards and forward across the double strand. For example, the sequence of base pairs GAATTC is a palindrome because both sequences of the double strand READ THE SAME when read from either their respective "G" or "C" ends ( COMPLEMENTARY strand = CTTAAG). The enzymes that cut these specific sites are called RESTRICTION ENZYMES (RE). Based on the TYPES OF CUTS they make, there are two types of RE:

One group cuts straight across the double stranded DNA, producing BLUNT ENDED DNA (Fig. 2).

Another type cuts the strand of DNA OFF THE CENTER of the palindromic sites, but between the SAME TWO BASES on the opposite strands. This leaves one or more bases overhanging on each strand and such ends are called STICKY ENDS (Fig. 1) because they form HYDROGEN BONDS with their complementary cut counterparts.

For example, in the base sequence G A ATTC, the RE that cuts this site cleaves the DNA between the " G " and the " A " on each complementary strand , thus leaving the overhangs of AATT & TTAA respectively (Fig. 1). Over 200 different RE have been isolated that cut at many different specific DNA sequences. They are all QUITE SPECIFIC and this specificity is the KEY to their use. REs that cut at 4, 5, 6, 8, 9, and 11 base pair palindromic sites have been found. It follows that the MORE BASE PAIRS in the palindromic site the LESS LIKELY a site is to exist statistically. That is, a 4-base-cutting RE cuts the same DNA many more times than an 8-base-cutter does. The odd numbered cutting sites are not true DNA palindromes, in that the central bp reads different in the two directions. For example AA?TT is a 5 bp cutting site, where the ? = a number of different bases.

Figure 1. Sticky ended cut with restriction enzyme. The red arrows indicate the positions where the RE cuts the DNA. When the complementary stands pull away the "sticky end" overhangs are left.

Figure 2. Blunt ended cuts by a restriction enzyme. Blunt end cutting REs cleave the DNA between two bases in the middle of a palindromic site.

CRITICAL THINKING QUESTION: The following are examples of RE DNA sites on a single strand. Add the complementary bases and find the RE sites: CCTAGT AATCCTAGGACG AAATTAATCGG TAAGGCGCGCCTAAT TACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGTATCCCCGGGTACCGAGCTCGAATTCACT.

There are 10 RE sites in this last one, can you find all ten?

The final important component in genetic engineering is an enzyme called LIGASE . Ligase is an enzyme that covalently joins the sugar-phosphate backbone of bases together. Ligase is also involved in DNA replication. In effect LIGASE reverses the action of the RE, which breaks the sugar-phosphate backbone-bonds. Ligase requires energy to form these bonds (Fig. 3). Ligase will join either "sticky" ends or "blunt" ends, but it is more efficient at closing sticky ends because the "sticky overhangs" of these ends adds stability which holds the stands together while the ligase works, whereas the blunt ends are LESS STABLE . The sticky ends must have the SAME "base overhang" (Fig. 1), but ANY BLUNT END can be joined to any other blunt end (Fig. 2).

Figure 3. The ligase reaction. The sticky ends of two DNA strands line up according to their bp hydrogen bonding. The cut sites are indicated by the blue arrows. The ligase binds to the hydrogen-bonded DNA strands and forms covalent bonds between the two DNA ends ( red bonds ), thus joining them. Similarly, if the blunt ends of DNA come together the ligase can form covalent bonds between them.

Review of the components of GE:

(1) Double-stranded DNA contain palindromic restriction enzyme sites.

(2) Many types of restriction enzymes cut or cleave palindromic sites in the double-stranded DNA sample forming either a sticky or a blunt end.

(3) The enzyme ligase plus an energy source fuses or join two sticky or two blunt ends of DNA together.

THE STEPS IN GENETIC ENGINEERING

Isolating the SOURCE and VECTOR DNA. The DNAs must be relatively free of contaminating materials which interfere with the subsequent enzymatic steps.

Both the source and vector DNAs are cut with RESTRICTION ENZYMES . When sticky ends are formed the DNA is cut with the same restriction enzyme(s), but RE that produce blunts ends also work well in cloning.

The vector and source DNAs are mixed with a LIGASE SYSTEM and covalently bond together.

Finally, the LIGATED DNA is TRANSFORMED into a host cell. Usually the host cell is a COMPETENT bacterium, but increasingly eukaryotic cells are being used. After suitable growth has occurred the host cells are examined for the PRESENCE of the source or CLONED DNA in its cytoplasm.

The entire cloning process often takes LESS THAN A DAY and is carried out using volumes of 1,000 microliters or less. The examination of the transformed host for the gene-of-interest may take an additional day or so. A gene which has been successfully transferred in this way is said to have been CLONED . The process is referred to as " CLONING ", " RECOMBINANT DNA TECHNOLOGY ", or " RECOMBINANT DNA ". These steps are summarized in the figure 4 below.

Figure 4. Cloning. For another figure illustrating cloning click here and view Fig. 11a.

USES OF CLONED DNA.

SEQUENCING : Sequencing determines the base pair sequence of a gene. By reading the 3-letter code, sequencing also describes the AMINO ACID SEQUENCE translated from that gene.

MUTATION : The gene bp sequence can be changed in specific ways and the modified gene can be inserted back into its original host to see what each specific mutation does. Whereas, spontaneous mutation is random, techniques are now available that make it possible to CHANGE any codon within a gene to any other codon. Therefore, it is possible to study the effects of SINGLE AMINO ACID CHANGES on the function of the gene product, which is, after all, the ultimate purpose of the exercise.

To replace a mutated form of the gene in the original host cell with a healthy form of the gene to see exactly what it does in its intended place of residence.

To use the amplified gene to make HUMONGOUS QUANTITIES of the GENE PRODUCT for commercial purposes. This is how products like human insulin, human growth hormone, plasminogen activator, interlukins and the bovine milk hormone are all produced.

To INSERT the gene into ANOTHER SPECIES for some purpose. Such animals or plants are said to be TRANSGENIC . For example, many crops are protected against caterpillar larvae because a gene from a bacterium has been inserted into their cells. This gene produces a protein that is HIGHLY, and SPECIFICALLY, TOXIC to the larvae of many moths and butterflies that attack food crops.

TRANSGENIC ORGANISMS

There is a DOWN SIDE of GE. The same procedures that can be used to produce a better crop, or human insulin, can also be employed to make a more POWERFUL PATHOGEN . There is evidence that some countries have or are considering doing this. For example, Iraq was apparently growing bacterial pathogens for biological warfare, but it was deterred from using them when we threatened atomic retaliation. It is only a small jump in "reasoning" to consider engineering a "better pathogen" with which to destroy a hated enemy (fill in blank--the news report that some Americans. consider anyone working for the government to be the enemy). For more information read " The spectra of biological weapons " Scientific Am. Dec. 1996, pg. 60.

Figure 5. The use of gene cloning to amplify the cloned DNA and/or to produce lots of the cloned gene's product.

CRITICAL THINKING QUESTION: What should we do about regulating genetically engineered plants and animals? Should we require that they be tested for safety, that they be labeled as GE? Can you think of any other considerations regarding these "products"? Will you eat "genetically engineered foods"?

DNA FINGERPRINTING

The THREE basic principles required to understand DNA fingerprinting and all that follows from it you already know (the principle of ligand/receptor binding see fig.2 chap 7 ), but it is worth taking a moment to review them.

BASE-PAIRING of AT (AU) & GC is the BASIC PRINCIPLE of this procedure. If you understand this all else fall easily into place.

SPECIFICITY of enzyme activity is the second CRUCIAL principle to understanding DNA fingerprinting. This refers to the cutting of DNA by specific RESTRICTION ENZYMES at UNIQUE palindromic sequences.

The recognition that a CHANGE in a SINGLE BASE PAIR (a mutation) can either MAKE a RE-site where one did not exist previously or it can REMOVE or ELIMINATE a RE site from a gene. An analogy would be to "mutate" your phone number by one letter callers would get a different person.

To understand DNA fingerprinting the double stranded DNA molecule must be viewed as a chain with RANDOM RESTRICTION ENZYMES -sites (palindromes) located along its length. If each of these various unique restriction sites were marked with a different color, the DNA would appear as a random multicolored stripped ribbon. If one set of unique restriction enzyme sites were colored RED and the appropriate RED -restriction enzyme added, the DNA would be CLEAVED into a series of VARIOUS SIZED FRAGMENTS depending on where the RED -SITES were located along the DNA molecule (Fig. 6). It is easy to understand that the group of DIFFERENT SIZED FRAGMENTS would be UNIQUE for two DNA strands with the RED -restriction sites located at DIFFERENT PLACES along their respective DNA double strands. The addition of a GREEN -restriction enzyme that cut GREEN -SITES would produce a different group of sized fragments. Each of these groups of restriction enzyme-produced fragments would represent a unique FINGERPRINT of that DNA (Fig. 6).

Figure 6. In this FIGURE there are two genes with the palindromic sites for two different restriction enzymes MARKED AS GREEN OR RED BARS. The number and size of the DNA fragments that would result if the DNA containing these two genes were cut with the respective restriction enzymes are shown. Determine the pattern you would get if you cut this DNA with BOTH ENZYMES at the SAME TIME lay it out from the smallest to the largest fragment.

The DNA fragments are visualized using the technique known as GEL ELECTROPHORESIS, which you performed in lab exercise 15. Briefly, porous gels composed either of a PLASTIC called ACRYLAMIDE or of a derivative of agar, called AGAROSE , are used to separate DNA fragments based on size. The gels are prepared with wells into which the DNA fragments are ADDED. The gels are submerged, under an electrolyte buffer solution between a positive and a negative electrode the DNA-containing solutions are added to the wells and the current is turned on. The DNA fragments are NEGATIVELY CHARGED so the wells containing them are placed closest to the negative electrode. When the current is turned on the DNA moves through the pores in the gel TOWARDS THE POSITIVE ELECTRODE . The shorter fragments move FASTEST because they are able to navigate through the pores of the gel more easily, whereas the longer DNA fragments move PROPORTIONALLY MORE SLOWLY through the pores. The result is a separation of the DNA fragments based on their length ( SIZE ). The DNAs are stained by dyes that binds to the DNA and fluoresces strongly when exposed to UV-light. The various sized DNA fragments appears as a series of bands that resemble a BAR CODE . See Fig. 13.

MUTATIONS & DNA-FINGERPRINTING

In Figure 7 the gel pattern of a hypothetical analysis of O.J.'s DNA vs. a sample of unknown DNA is depicted. The two isolated DNAs were treated with the same RE and the fragments separated on an agarose gel. Two unique restriction enzyme fragment patterns are seen. The conclusion is that the blood samples came from DIFFERENT INDIVIDUALS . The SOURCE of the DNAs clearly influences the significance of these results. For example, if the two samples were collected at the scene of the crime it would mean one thing, but if the unknown DNA sample came from O.J.'s shirt and it matched that of one of the victims at the scene of the crime, the data takes on more significance.

Figure 7. Clearly the DNA from the scene-of-the-crime is not that of O.J., as the fragment patterns (the DNA fingerprint) are different. Had they been the same what would that of said about the innocence or guilt of O.J.?

HYBRIDIZATION

ANSWER: This is exactly what happens. When genomic DNA is treated with a RE and separated on a gel, what is seen is a continuous smear composed of 1,000s of individual DNA fragments. This problem is solved by a technique known as HYBRIDIZATION .

Hybridization again depends on the basic principle of HYDROGEN BONDING between GC & AT bonds in nucleic acids. The principles in the hybridization steps are:

DNA strands are SEPARATED by breaking the hydrogen bonds between the bases with heat to produce SINGLE STRANDS .

Strand separation is STRICTLY DEPENDENT up on two factors: The TEMPERATURE (amount of heat energy) and the NUMBER of hydrogen bonds (an incorrect base pairing does NOT form H-bonds).

When the temperature drops, single DNA strands in the same solution that are complementary SPONTANEOUSLY COME TOGETHER by pairing up through their respective AT & GC associations. The strength of their subsequent association depends on the temperature and the total number of MATCHING base pairs.

The TEST or SAMPLE DNA is usually FIXED or BOUND to a solid surface in a SINGLE-STRANDED STATE . A piece of DNA of KNOWN SEQUENCE to which something is attached that can be DETECTED or SEEN is then mixed with the bound DNA and the two are incubated together under conditions that will allow COMPLEMENTARY DNA sequences to join through the appropriate hydrogen bonding. The DNA molecule which can be detected is called a PROBE .

Figure 8. Hybridization probe. A short piece of DNA of known sequence (black bases) has a REPORTER substance attached to it. This reporter is usually a radioactive element like phosphorous-32 or an enzyme that induces light production from a substrate molecule and is indicated in this figure by the light bulb. If the probe sequence finds a complementary base sequence on the bound target or sample DNA, it will hydrogen-bond to it. When the excess, unbound probe is washed away the location of the bound probe and its complementary DNA can be detected by the REPORTER on the probe.

That is, the MORE hydrogen bonds there are the HIGHER the temperature must be to completely SEPARATE two DNA strands and to keep them separated. For example, if there were two stands of DNA composed of 200 PERFECTLY complemented base pairs, then it would take a temperature of 58 o C. to separate them. However, if only 199 of the base pairs were correct, it would only take 57 o C. to separate them if there were only 100 correct base pairs the DNA strands would fall apart at

29 o C i.e., fewer bonds require less heat (energy = lower temperatures) to rupture them.

Figure 9. In this figure a short piece of DNA, called the PROBE (Pink Star) is mixed with two different long DNA strands. One of these long strands contains a sequence of bp that exactly matches that of the probe, whereas the other differs with respect to a single bp (yellow oval). At 55 o C the probe binds to BOTH long DNA molecules, however at 65 o C the probe does not bind to the long DNA molecule with a single base pair mismatch. The probe is unable to bind to either long DNA molecule at 90 o C. What do you think might be the results at a temperature of 60 o C?

  1. The isolated DNA is FRAGMENTED ( CUT ) with restriction enzymes.
  2. The cut-DNA is separated into fragments according to SIZE on a gel.
  3. The DNA fragments are transferred, IN POSITION , to a membrane to which they TIGHTLY BIND .
  4. The membrane-bound-DNA is soaked in a solution containing PROBE-DNA that is labeled with something that can be DETECTED (seen by the eye).
  5. The membrane-bound-DNA-probe mixture is incubated at a temperature designed so that ONLY THE PROBE DNA strands that have a high degree of COMPLEMENTARITY (base pair matching) to DNA strands bound to the membrane will be able to bind (Hydrogen-bond) to each other.
  6. The unbound probe is washed away and the position of the bound probe is determined using its detection system of the probe.

Figure 10. The hybridization procedure.

The entire procedure is called HYBRIDIZATION . Hybridization works because of the SEQUENCE OF THE PROBE . A given probe will only bind with DNA that is attached to the membrane IF IT FINDS a MATCHING or COMPLEMENTARY DNA base pair sequence that forms enough bonds to remain together under the heating conditions used. Thus if no matching complementary sequences are found, NO PROBE will bind (Fig. 10, green DNA ). If one or two of the 1,000s of the bound DNA fragments contain a sequence complementary to the sequence in the probe, the probe will BIND only to these fragments and thus become ATTACHED TO THE MEMBRANE through this association with the complementary membrane-bound-DNA (Fig. 10, red DNA ). It is possible to chose probes that are known to bind to specific sequences or artificial probes of KNOWN SEQUENCES can be made, for about $1.00/base and sent to you in 48 hr. THEY CAN BE ORDERED OVER THE INTERNET.

Figure 11. The original gel, shown in the middle, produces a smear of genomic DNA fragments (see Fig. 13). Within those 1000,s of fragments are the fragments shown on the left gel cut from a section of the two original DNA molecules shown in the upper left. When the smear of fragments, fixed to a membrane, are hybridized with the probe (DNA with attached reporter [ green star ], Fig. 8), the probe will HYBRIDIZE (bind) only to those fragments containing sequences of DNA that complement sequences present in the probe i.e., those regions DIRECTLY BELOW the probe DNA. The location ( pink ovals ) of such complementary membrane-bound-fragments are shown on the gel at the right. Thus the detection system only "SEES" the pink ovals. See Fig. 13 for X-ray film detection of DNA fragments from a genomic DNA smear.

Figure 12. Homework project.

In Fig. 12 three different PROBES (A, B, & C) are hybridized against the separated membrane-bound-DNA fragments shown on the right (from 3 duplicate gels). As an exercise determine WHICH BANDS each of the three probes will hybridize (bind) to that is, draw three duplicate gels, 1, 2, & 3 and circle the band(s) in gel 1 that probe A will bind to in gels 2 & 3 do the same with probes B & C respectively.

Figure 13. These are three experimental gels showing the outcome of a hybridization procedure. Gel A shows the banding pattern seen when genomic DNA, digested with a restriction enzyme, is separated on an agarose gel. The smears in lanes 1 to 9 represent 1,000s of individual DNA fragments produced by the restriction enzyme digestion. The banding seen in these lanes is due to the high concentration of certain genes. Gels B & C show examples of banding patterns obtained when genomic DNA smears, bound to a membrane, are hybridized with specific probes . The probes only bind, or hybridized to, a few of the 1,000s of fragments that contained base sequences COMPLEMENTARY to those on the probe. Attached to the probes is substance which produces LIGHT when treated with certain chemicals and this light is detected with photographic film, in effect taking a picture of each of the locations where the probes bind to a complementary DNA fragment on the membrane. click here and then click on "Hybridization" for some other cartoons of Southern Blotting and illustrations of other molecular biology techniques.

Figure 14 illustrates how the blood from O.J.'s trial was tested to determine matches. The DNA from the various samples of blood (from the gloves, the Bronco, the socks, the bodies etc.) was extracted, digested with one or more restriction enzymes, separated on gels, transferred to DNA-binding membranes and hybridized with various probes. The pattern of the DNA fragments (bands) from the samples that "lights up" were then compared for similarities and differences.

FAQ: About DNA fingerprinting.

1 How good (accurate) is it at identification. For example, is it as good as classical fingerprints?

Answer: In theory, with the exception of identical twins, EVERYONE on this planet has a different DNA fingerprint. That is, DNA fingerprinting IS as good (distinctive) as classical fingerprinting for identification.

2. What are its advantages?

Answer: In theory DNA fingerprinting will work with much smaller amounts of material than a classical fingerprint & DNA lasts much longer than classical fingerprints. DNA-containing samples that are many years old (up to 25 million yr.) are still usable. Only very tiny quantities of DNA are required in order to carry out a highly accurate test. For example, dried blood, semen, spit, skin etc. on samples stored in dusty files for years are still usable. Samples of mixed DNA's can also be used. DNA containing evidence is much harder to clean up at a crime scene than other evidence, like classical fingerprints.

3. What are its limitations?

Answer: There currently are no accepted Federal standards for controlling the quality of DNA testing nationwide. Poor quality & poorly controlled testing leads to QUESTIONABLE and SHODDY RESULTS . Lab A may use one set of procedures and standards, whereas, lab B may use another set of procedures and standards. Making comparisons between results from the two labs difficult. The quality of laboratory personal is not standardized. For example, clinical laboratory technicians, that work in hospitals and clinical labs, must be certified by their states and by a national organization that sets high standards of training and experience. The clinical labs are frequently tested to determine if their procedures are done correctly. They receive & must analyze test samples whose composition is known by certification agencies. The results are returned to the certification agencies for evaluation. If a clinical lab makes too many errors the lab will be DECERTIFIED. This is not yet the case with DNA testing facilities.

Do you think there should be a set of national standards for DNA testing or should each state set their own standards?

Even if there is a perfect match between DNAs, you can not say HOW the DNA containing sample got there or WHEN . In the O.J. trial a VALID question was raised about the possibility of evidence being planted. What makes this charge so powerful is the EXTREME SENSITIVITY of the procedure. That is, it would NOT BE DIFFICULT for someone to collect a small quantity of blood (one or two drops from a tube of a blood sample), body fluid or tissue from a victim (e.g. hair in a comb, blood on a Kleenex etc. ) and place this material where it would incriminate an innocent person. There are documented cases where quantities of drugs, marked money etc. have been "planted" and innocent people convicted of crimes because of these actions.

Finally, blood that is mixed with the wrong chemicals or is degraded is difficult to analyze accurately.

4. When faced with DNA evidence what questions should be asked?

Answer: As indicated above (and in the O.J. trial), questions regarding the handling of the evidence, the quality of the testing, including the quality controls used, the skill of the testing personnel, the accuracy of the data interpretation, possible contamination of the evidence, the possibility of accidental, or intentional misplacement of evidence are all valid questions that should be raised regarding DNA evidence (or any evidence for that matter). As the sensitivity of this powerful technique improves and its use widens throughout our justice system, it is important that we deal with these problems if we expect EQUAL JUSTICE for all. We must not lose sight of the fact that no matter how powerful a new tool in crime fighting is, its ultimate effectiveness is only as good as the persons using that tool .

Do you think O.J. did it and if so, how would you have voted based only on the evidence had you been a jury member?

POLYMERASE CHAIN REACTION

The PCR is another one of these discoveries, like that of the structure of DNA, the transforming factor determining the chemical nature of DNA, and restriction enzymes, that generated a quantum leap in science. Almost the instant after PCR is explained to a biological scientist, ideas as to its uses begin to pour from all but the most dull scientific mind. Even today, years after its discovery, we are still developing new uses for PCR.

The irony of the PCR is that living organisms have been doing it since they evolved in the primeval organic soup of this planet 3.5 billion years ago and scientists have been aware of the general DETAILS of this process for

50 years. To put it succinctly, the PCR does in the test tube what every bacterium does in its tube of media or on an agar-plate and each of us do every day we all produce billions of exact copies of our own DNA AMPLIFYING our DNA millions of time. The enzyme DNA polymerase was discovered in the 1950s and our knowledge of the process has been increasing ever since. This means that thousands of scientists have studied DNA replication for 40 years without tumbling to PCR.

The basic principle of PCR is shown in Fig. 15. It has been know for a long time that DNA polymerase requires a short stand of DNA or RNA called a PRIMER to "prime" the START OF DNA REPLICATION . Mullis's genius was that he reasoned " That if you added the following components to a test tube containing a single DNA molecule , you could replicate & amplify that DNA molecule many million fold in a short time .

A sample of the TARGET DNA to be copied. In theory only a single molecule is needed.

A set of short (15 to 40 bases) single stranded PRIMERS of DNA, in EXCESS , that will bind to complementary regions of the opposing stands of the TARGET DNA molecule . These primers BRACKET the region of DNA to be amplified.

An EXCESS of the 4 nucleotide triphosphates, ATP, GTP, CTP, TTP.

The enzyme, DNA polymerase.

Various buffers and cofactors like magnesium ions required by DNA polymerase.

The final trick was to get the two target DNA stands APART (separated) so the primers could bind and the DNA polymerase could do its thing. It had been known for

50 years that heat separates DNA stands and that complementary strands then rejoin through base pairing when the temperature is subsequently lowered. So Mullis heated his mixture of target DNA, primers and triphosphate nucleotides to about 90 o C for a few minutes to separate the target DNA. He then lowered the temperature enough to allow the primers, which were small and in VAST EXCESS , to bind ( ANNEAL ) to their respective complementary target DNA bp-sequences. At this point he added DNA polymerase and allowed the polymerization reaction with the triphosphate nucleotides to occur. That is, the DNA polymerase FILLED IN the missing portion of each strand making TWO NEW DOUBLE STRANDED regions of DNA.

Figure 15. The polymerase chain reaction. For another figure illustrating the PCR click here and view the "PCR" link.

Each entire PCR cycle takes only 2 to 10 minutes. However, there was one problem with the system devised by K. Mullis, which was that the DNA polymerase he used was DESTROYED BY THE HEATING process. Mullis had to add new DNA polymerase for EACH ROUND, which was time-consuming and expensive. This problem was solved by using HEAT-RESISTANT DNA polymerase that only needed to be added once. THERMOPHILIC bacteria that live in boiling hot springs have been described previously. This is another case of SERENDIPITOUS BASIC SCIENCE turning out to be important. The study of thermophiles might seem to be a waste of money and time to many people as these bacteria, while certainly interesting, don't cause disease in man or any other life form. The argument could be made that a scientist could better spend his/her time working on cancer or some other terrible disease that afflicts humankind. However, it turns out that since thermophilic DNA polymerases tolerate high temperatures (e.g. 90 o C) for long periods without being destroyed, they are the perfect solution to the PCR DNA polymerase problem. Thus today PCR has become a revolutionary tool because of scientists who studied these odd thermophiles.

Figure 16. This figure represents another perspective of the PCR reaction. Of particular note is the use of the PCR to AMPLIFY SPECIFIC DNA SEGMENTS dependent on the PRIMERS EMPLOYED. By choosing primers with unique sequences one BRACKETS a known length (gene[s])of a DNA molecule. The bracketed segment is indicated by the dashed lines. The red and blue primers, by their COMPLEMENTARY BINDING to bp-sequences on the two respective parental DNA strands insure that ONLY the portion of DNA between them will be amplified. Five cycles of replication are shown, except that the last cycle is incomplete. Note that the number of DNA molecules increases EXPONENTIALLY with each cycle of replication.

The standard PCR reaction is run through about 30 cycles in a couple of hours which results in the amplification of the original DNA by over a 10 9 fold. Thus a single specific DNA region can be amplified to yield sufficient quantities to do anything that can be done with bulk-isolated DNA. In the case of crime evidence this means that the DNA in a single hair follicle, a single drop of semen or blood is sufficient to prove that an individual was present at the scene of a crime. Indeed any piece of evidence that contains one or more moderately long DNA fragments (e.g. >200 base pairs) can be amplified with PCR and its RFLP determined for identification purposes---or maybe to build a dinosaur eventually. However, at present the maximum limit for amplification is approximately 42 kilobases.

SUMMARY OF DNA FINGERPRINTING

The major limitations of DNA fingerprinting are human error and the quality of the technology used.

The discovery of PCR increased the sensitivity and versatility of DNA fingerprinting, and changed the face of molecular biology.

These techniques will allow infectious diseases to be identified within hours or even minutes. They are accelerating the rate of sequencing the human genome, they allow the investigation of complex ecological interactions and species relationships that here-to-fore have been too complex to study.

WELCOME TO THE NEW WORLD OF GENETIC ENGINEERING JUST KEEP YOUR SEAT BELTS FASTENED BECAUSE IT IS GOING TO BE A WILD RIDE.


What happen if we inject restriction enzyme into the blood - Biology

and the larger fragments near the negative electrode .

---------------

Once the gel has been "run," the only task remaining is to illuminate the DNA fragments. With PCR, the entire gel is simply

soaked in a staining solution. The DNA fragments appear as little bands on the gel and we can determine their approximate

length by their position on the gel. To illuminate the DNA profile from an RFLP analysis, we first need to expose it to

radioactively labeled probes, which specifically target the STR sequences that we are trying to find. Then we can expose

it to an X-ray film, which will visualize only the fragments that were detected by the radioactively labeled probes. As long

as the same techniques are used in preparing all the samples in a test, a direct comparison of the DNA profiles is an

accurate way to match identities or confirm relationships. A person's DNA profile will be approximately a 50/50

combination of his or her mother and father. An exact DNA profile match either indicates that both samples were